RNA-guided human genome engineering
AssigneePresident and Fellows of Harvard College
InventorsPrashant G. Mali, George M. Church, Luhan Yang
Life of this patent
Estimating the term…
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims33
A method of altering a eukaryotic cell comprising
- providing to a eukaryotic cell a first guide RNA comprising a scaffold sequence and a spacer sequence complementary to a first target nucleic acid sequence and a second guide RNA comprising a scaffold sequence and a spacer sequence complementary to a second target nucleic acid sequence, wherein each guide RNA is a crRNA-tracrRNA fusion of between 100 to about 250 nucleotides,
- providing to the cell a Cas enzyme of a Type II CRISPR system,
- wherein the first guide RNA binds to the first target nucleic acid sequence, the second guide RNA binds to the second target nucleic acid sequence and the Cas enzyme cleaves the first and second target nucleic acid sequences in a site specific manner to remove an intervening fragment.
A method of altering a eukaryotic cell comprising
- providing to a eukaryotic cell a first guide RNA comprising a scaffold sequence and a spacer sequence complementary to a first target nucleic acid sequence and a second guide RNA comprising a scaffold sequence and a spacer sequence complementary to a second target nucleic acid sequence, wherein each guide RNA is a crRNA-tracrRNA fusion of between 100 to about 250 nucleotides,
- providing to the cell a Cas enzyme of a Type II CRISPR system,
- wherein the first guide RNA binds to the first target nucleic acid sequence, the second guide RNA binds to the second target nucleic acid sequence and the Cas enzyme cleaves the first and second target nucleic acid sequences in a site specific manner to remove an intervening fragment,
- wherein the scaffold sequence of the first guide RNA and the scaffold sequence of the second guide RNA each comprise
- (SEQ ID NO:
- 46)
- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
- UUGAAAAAGUGGCACCGAGUCGGUGC.
A method of altering a eukaryotic cell comprising
- providing to a eukaryotic cell a first guide RNA comprising a scaffold sequence and a spacer sequence complementary to a first target nucleic acid sequence and a second guide RNA comprising a scaffold sequence and a spacer sequence complementary to a second target nucleic acid sequence, wherein each guide RNA is a crRNA-tracrRNA fusion of between 100 to about 250 nucleotides,
- providing to the cell a Cas 9 enzyme,
- wherein the first guide RNA binds to the first target nucleic acid sequence, the second guide RNA binds to the second target nucleic acid sequence and the Cas 9 enzyme cleaves the first and second target nucleic acid sequences in a site specific manner to remove an intervening fragment.
Dependencies are inferred from the claim text.