Back to results
US 11,230,713 B2Granted
Oligonucleotide compounds for targeting huntingtin mRNA
AssigneeUniversity of Massachusetts
InventorsAnastasia Khvorova, Neil Aronin, Julia Alterman
Life of this patent
Estimating the term…
Abstract
This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.
Claims30
A recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence that encodes an RNA duplex;
- wherein the RNA duplex comprises a sense strand and an antisense strand;
- wherein the antisense strand is between 16 and 22 nucleotides in length and comprises a region of complementarity;
- and wherein the region of complementarity in the antisense strand is complementary to at least 16 contiguous nucleotides of 5′ GCCUGCUAGCUCCAUGCUUA 3′ (SEQ ID NO:
- 17).
1 more element
Dependencies are inferred from the claim text.