# US 11,028,392 B2 · Compositions and methods for inhibiting expression of the ALAS1 gene

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 11,028,392 B2
- Document ID: US11028392B2
- Status: Granted
- Kind: B2
- Application number: 16/137,046
- Filed: 2018-09-20
- Published: 2019-05-16
- Granted: 2021-06-08
- Earliest claimed: 2013-10-04
- Assignees: Alnylam Pharmaceuticals, Inc.; Icahn School of Medicine at Mount Sinai
- Applicants: Alnylam Pharmaceuticals, Inc.; Icahn School of Medicine At Mount Sinai
- Inventors: Brian Bettencourt; Kevin Fitzgerald; William Querbes; Robert J. Desnick; Makiko Yasuda
- Web page: https://patentgrep.com/patent/US11028392B2

## CPC

- C12N 15/1137: {against enzymes (viral enzymes C12N15/1131; receptors C12N15/1138)}
- A61K 9/0019: {Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner (non-active ingredients are additionally classified in A61K47/00)}
- A61P 1/16: for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
- A61P 3/00: Drugs for disorders of the metabolism (of the blood or the extracellular fluid A61P7/00)
- A61P 7/00: Drugs for disorders of the blood or the extracellular fluid
- A61P 25/00: Drugs for disorders of the nervous system
- A61P 25/04: Centrally acting analgesics, e.g. opioids
- A61P 43/00: Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
- C12Q 1/6876: Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12N 2310/14: interfering nucleic acids [NA]
- C12N 2310/315: Phosphorothioates
- C12N 2310/321: 2'-O-R Modification
- C12N 2310/341: Gapmers, i.e. of the type ===---===
- C12N 2310/345: having at least two different backbone modifications
- C12N 2310/351: Conjugate
- C12Y 203/01037: 5-Aminolevulinate synthase (2.3.1.37)
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C12Q: MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS (immunoassay G01N33/53); COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Y: ENZYMES

## Abstract

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.

## Claims

### Claim 1

A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 22 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).

### Claim 2 (depends on 1)

The dsRNA of claim 1, wherein said dsRNA comprises at least one modified nucleotide.

### Claim 3 (depends on 1)

The dsRNA of claim 1, wherein the dsRNA comprises a duplex region which is 21-23 nucleotide pairs in length.

### Claim 4 (depends on 1)

The dsRNA of claim 1, wherein at least one strand comprises a 3′ overhang of at least 2 nucleotides.

### Claim 5 (depends on 1)

The dsRNA of claim 1, wherein each strand is no more than 26 nucleotides in length.

### Claim 6 (depends on 2)

The dsRNA of claim 2, wherein at least one modified nucleotide is chosen from a 2′-O-methyl, a 2′-fluoro modified nucleotide, or both.

### Claim 7 (depends on 6)

The dsRNA of claim 6, further comprising a ligand.

### Claim 8 (depends on 7)

The dsRNA of claim 7, wherein the ligand comprises a carbohydrate.

### Claim 9 (depends on 8)

The dsRNA of claim 8, wherein the ligand is

### Claim 10 (depends on 1)

The dsRNA of claim 1, wherein the sense strand comprises or consists of the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).

### Claim 11 (depends on 1)

The dsRNA of claim 1, wherein:
(i) the antisense strand comprises the sequence of SEQ ID NO: 4157, and/or the sense strand comprises the sequence of SEQ ID NO: 4156, or
(ii) the antisense strand consists of the sequence of SEQ ID NO: 4157, and/or the sense strand consists of the sequence of SEQ ID NO: 4156.

### Claim 12 (depends on 1)

The dsRNA of claim 1, wherein:
(i) the antisense strand comprises the sequence of SEQ ID NO: 4165, and/or the sense strand comprises the sequence of SEQ ID NO: 4164, or
(ii) the antisense strand consists of the sequence of SEQ ID NO: 4165, and/or the sense strand consists of the sequence of SEQ ID NO: 4164.

### Claim 13 (depends on 1)

A vector encoding at least one strand of a dsRNA of claim 1.

### Claim 14 (depends on 1)

An isolated cell comprising the dsRNA of claim 1.

### Claim 15 (depends on 1)

A pharmaceutical composition for inhibiting expression of an ALAS1 gene, the composition comprising the dsRNA of claim 1.

### Claim 16 (depends on 1)

A method of inhibiting ALAS1 expression in a liver cell, the method comprising:
(a) introducing into the cell the dsRNA of claim 1, and
(b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cell.

### Claim 17 (depends on 1)

A method for decreasing a level of a porphyrin or a porphyrin precursor in a cell, comprising contacting the cell with the dsRNA of claim 1, in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell.

### Claim 18 (depends on 1)

A method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of the dsRNA of claim 1, thereby treating the porphyria.

### Claim 19 (depends on 18)

The method of claim 18, wherein the porphyria is acute intermittent porphyria or ALA-dehydratase deficiency porphyria.

### Claim 20 (depends on 18)

The method of claim 18, wherein (i) the dsRNA is administered after an acute attack of porphyria, (ii) the dsRNA is administered during an acute attack of porphyria, or (iii) the dsRNA is administered prophylactically to prevent an acute attack of porphyria.

### Claim 21 (depends on 18)

The method of claim 18, wherein the dsRNA is administered at a dose of 0.05 mg/kg to 50 mg/kg, 0.01 mg/kg to 5 mg/kg, or 1 mg/kg to 2.5 mg/kg bodyweight of the subject, or at a dose of 1 mg/kg, 2.5 mg/kg, or 5 mg/kg bodyweight of the subject.

### Claim 22 (depends on 18)

The method of claim 18, wherein the method
(i) decreases a level of a porphyrin or a porphyrin precursor in the subject, wherein the porphyrin precursor is δ-aminolevulinic acid (ALA) or porphopilinogen (PBG), wherein the level is decreased by at least 40%; and/or
(ii) inhibits ALAS1 expression by at least 40% in the subject.

### Claim 23 (depends on 18)

The method of claim 18, wherein said method (i) ameliorates a symptom associated with an ALAS1 related disorder, (ii) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor.

### Claim 24 (depends on 18)

The method of claim 18, wherein the dsRNA weekly, biweekly, or monthly.

### Claim 25 (depends on 18)

The method of claim 18, wherein the subject has an elevated level of ALA and/or PBG.

### Claim 26 (depends on 18)

The method of claim 18, wherein the method decreases or prevents pain, neuropathy, and/or nerve damage.

### Claim 27 (depends on 15)

The pharmaceutical composition of claim 15, comprising about 200 mg/mL of the dsRNA.

### Claim 28 (depends on 15)

The pharmaceutical composition of claim 15, wherein the pharmaceutical composition has a pH of 6.0-7.5.

### Claim 29 (depends on 1)

The dsRNA of claim 1, wherein the ALAS1 RNA transcript comprises the sequence of SEQ ID NO: 1.

### Claim 30 (depends on 1)

The dsRNA of claim 1, wherein the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or all of the following:
(i) is chemically synthesized;
(ii) all the nucleotides in the dsRNA are modified;
(iii) all nucleotides are connected through 3′-5′ phosphodiester linkages;
(iv) the sense strand comprises or consists of 21 nucleotides;
(v) the antisense sense strand comprises or consists of 23 nucleotides;
(vi) has a blunt-end at the 3′-end of sense strand;
(vii) has a 3′-overhang;
(viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;
(ix) the 3′-end of the sense strand is conjugated to the triantennary GalNAc moiety;
(x) has an antisense strand that comprises one or more phosphorothioate linkages;
(xi) has a sense strand that comprises one or more phosphorothioate linkages;
(xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand;
(xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3′-end of the antisense strand;
(xiv) comprises, or consists of, a sense strand having the sequence of SEQ ID NO: 4160 or 4162 and an antisense strand having the sequence of SEQ ID NO: 4161 or 4163;
(xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4160; or
(xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4161.

### Claim 31 (depends on 6)

The dsRNA of claim 6, wherein the dsRNA comprises one or more phosphorothioate linkages.

### Claim 32 (depends on 7)

The dsRNA of claim 7, wherein the ligand is conjugated to the 3′ end of the sense strand of the dsRNA.

### Claim 33 (depends on 8)

The dsRNA of claim 8, wherein the ligand is a GalNAc ligand.

### Claim 34 (depends on 16)

The method of claim 16, wherein the expression of ALAS1 is inhibited by at least 80% at 10 nM of the dsRNA as measured by branched DNA (bDNA) assay at 24 hours post-transfection.

### Claim 35 (depends on 18)

The method of claim 18, wherein the subject is at risk for developing, or is diagnosed with, a porphyria.

### Claim 36 (depends on 25)

The method of claim 25, wherein the subject suffers from chronic pain.

### Claim 37 (depends on 25)

The method of claim 25, wherein the method decreases or prevents pain, neuropathy, and/or nerve damage.