MLH1 methylation assay

A method for detecting methylation of a target nucleic acid sequence in the promoter of MLH1 in a sample comprising

• (a) incubating the sample comprising double-stranded genomic DNA with at least one methylation-sensitive restriction enzyme and at least one methylation-insensitive restriction enzyme, wherein
• (i) the methylation-sensitive restriction enzyme and the methylation-insensitive restriction enzyme are not isoschizomers of each other;
• (ii) the methylation-sensitive restriction enzyme cleaves the double-stranded genomic DNA at unmethylated recognition sites for the methylation-sensitive restriction enzyme, leaving methylated recognition sites for the methylation-sensitive restriction enzyme intact;
• (iii) the methylation-insensitive restriction enzyme cleaves the double-stranded genomic DNA at both methylated and unmethylated recognition sites for the methylation-insensitive restriction enzyme;
• (iv) the target nucleic acid sequence in the promoter of MLH1 in the sample comprises a recognition site for the methylation-sensitive restriction enzyme;
• and
• (v) a target nucleic acid sequence at intron 14 of MLH1 in the sample comprises a recognition site for the methylation-insensitive restriction enzyme;
• (b) incubating the sample with a plurality of probes for querying a plurality of target nucleic acids in the sample, wherein the plurality of probes comprises
• (i) a first locus specific probe comprising a first target specific region complementary to the target nucleic acid sequence in the promoter of MLH1, wherein the sequence of the first locus specific probe is 5′ AAGCACCTCCTCCGCTCTGC 3′ (SEQ ID NO:
• 1) or a complement thereof and wherein the first locus specific probe is a single oligonucleotide;
• and
• (ii) a second locus specific probe comprising a second target specific region complementary to the target nucleic acid sequence at intron 14 of MLH1, wherein the second locus specific probe is a single oligonucleotide and wherein the first locus specific probe and second locus specific probe are detectably labelled;
• (c) hybridizing the plurality of probes to the plurality of target nucleic acids in the sample to form a plurality of hybridization complexes;
• (d) amplifying the plurality of hybridization complexes via real-time quantitative PCR to produce a plurality of amplicons, wherein amplification is carried out with a plurality of primer sets comprising
• (i) a first forward primer comprising a region that is complementary to a nucleic acid sequence located 5′ from the target nucleic acid sequence in the promoter of MLH1;
• (ii) a first reverse primer comprising a region that is complementary to a nucleic acid sequence located 3′ from the target nucleic acid sequence in the promoter of MLH1;
• (iii) a second forward primer comprising a region that is complementary to a nucleic acid sequence located 5′ from the target nucleic acid sequence at intron 14 of MLH1;
• and
• (iv) a second reverse primer comprising a region that is complementary to a nucleic acid sequence located 3′ from the target nucleic acid sequence at intron 14 of MLH1;
• and
• (e) detecting the plurality of amplicons, wherein detecting an amplicon comprising the target nucleic acid sequence in the promoter of MLH1 indicates methylation of the target nucleic acid sequence in the promoter of MLH1 in the sample,
• wherein the sample is obtained from a formalin fixed paraffin-embedded tissue sample, and wherein the methylation-sensitive restriction enzyme is HhaI.