# US 10,793,924 B2 · Methods for detecting norovirus

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 10,793,924 B2
- Document ID: US10793924B2
- Status: Granted
- Kind: B2
- Application number: 16/306,203
- Filed: 2017-06-02
- Published: 2019-07-11
- Granted: 2020-10-06
- Earliest claimed: 2016-06-03
- Assignees: Quest Diagnostics Investments Incorporated
- Applicants: Quest Diagnostics Investments LLC
- Inventors: Peter Lee; Raymond Huang; Kristin Ramos; Jules Chen; Michelle Tabb
- Web page: https://patentgrep.com/patent/US10793924B2

## CPC

- C12Q 1/701: {Specific hybridization probes}
- A61P 31/14: for RNA viruses
- C12N 7/00: Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof (preparing medicinal viral antigen or antibody compositions, e.g. virus vaccines, A61K39/00)
- C12Q 1/68: involving nucleic acids
- C12Q 1/686: Polymerase chain reaction [PCR]
- C12Q 1/70: involving virus or bacteriophage {(immunoassay for viruses G01N33/56983)}
- G01N 33/56983: {Viruses}
- A61K 39/00: Medicinal preparations containing antigens or antibodies (materials for immunoassay G01N33/53)
- C12N 2770/16021: Viruses as such, e.g. new isolates, mutants or their genomic sequences
- C12Q 2600/106: Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
- C12Q 2600/112: Disease subtyping, staging or classification
- G01N 2333/08: RNA viruses
- C12Q: MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS (immunoassay G01N33/53); COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- G01N: INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES (measuring or testing apparatus or processes other than immunoassay, involving enzymes or microorganisms C12M, C12Q)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)

## Abstract

The present disclosure provides methods and compositions for determining whether a patient exhibiting acute gastroenteritis will benefit from treatment with therapeutic agents that inhibit Norovirus genogroup I (GI) or Norovirus genogroup II (GII). The methods disclosed herein are based on detecting Norovirus genogroup I (GI) and Norovirus genogroup II (GII) in a stool sample without extracting viral nucleic acids from a clinical specimen prior to performing real-time reverse transcription PCR. Kits for use in practicing the methods are also provided.

## Claims

### Claim 1

A method for detecting the presence of at least one Norovirus genogroup in a stool sample comprising:
contacting the stool sample with:
i. a first primer pair that amplifies a Norovirus genogroup I (GI) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 2 or a complement thereof; and
ii. a second primer pair that amplifies a Norovirus genogroup II (GII) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 4 or a complement thereof;
to produce a reaction-sample mixture under conditions where real-time RT-PCR amplification of the Norovirus genogroup I (GI) and Norovirus genogroup II (GII) target nucleic acids, if present in the stool sample, occurs without extracting the target nucleic acids from the stool sample.

### Claim 2 (depends on 1)

The method of claim 1, further comprising:
(a) subjecting the reaction-sample mixture to real-time RT-PCR conditions under which each of the target nucleic acids present in the stool sample is amplified to produce a fluorescent signal;
(b) detecting the fluorescent signal generated by each amplified target nucleic acid produced in step (a); and
(c) detecting the presence of at least one Norovirus genogroup in the stool sample by evaluating the fluorescent signal of each target nucleic acid, wherein detection of the Norovirus genogroup I (GI) target nucleic acid is indicative of the presence of Norovirus genogroup I (GI) in the stool sample; and detection of the Norovirus genogroup II (GII) target nucleic acid is indicative of the presence of Norovirus genogroup II (GII) in the stool sample;
wherein the stool sample is not subjected to an extraction or purification step prior to amplification.

### Claim 3 (depends on 1)

The method of claim 1, wherein the first primer pair consists of a first forward primer comprising 5′d CGYTGGATGCGITTYCATGA 3′(SEQ ID NO: 5) and a first reverse primer comprising 5′d TCCTTAGACGCCATCATCATTTAC 3′ (SEQ ID NO: 6) and/or wherein the second primer pair consists of a second forward primer comprising 5′d TGTTYAGGTGGATGAGRTTCTCIGA 3′ (SEQ ID NO: 9) and a second reverse primer comprising 5′d TCGACGCCATCTTCATTCACA 3′ (SEQ ID NO: 10).

### Claim 4 (depends on 1)

The method of claim 1, wherein Norovirus genogroup I (GI) comprises one or more genotypes selected from the group consisting of GI.1, GI.2, GI.3, GI.4, GI.5, GI.6, GI.7, GI.8, GI.9, GI.10 and GI.14 and Norovirus genogroup II (GII) comprises one or more genotypes selected from the group consisting of GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.8, GII.9, GII.10, GII.11, GII.12, GII.13, GII.14, GII.15, GII.16, GII.17, GII.18, GII.19, GII.20, GII.21, GII.22, and GII.23.

### Claim 5 (depends on 1)

The method of claim 1, further comprising contacting the stool sample with a first nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup I (GI) target nucleic acid sequence of SEQ ID NO: 2 or a complement thereof, wherein the first nucleic acid probe is detectably labeled and comprises 5′d TGGACAGGAGAYCGCIATCTCYTOCCCGA 3′ (SEQ ID NO: 7) or a complement thereof, and/or
a second nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup I (GI) target nucleic acid sequence of SEQ ID NO: 2 or a complement thereof, wherein the second nucleic acid probe is detectably labeled and comprises 5′d TGGACAGGAGATCGCAATCTACTGCCTGA 3′(SEQ ID NO: 8) or a complement thereof, and/or
a third nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup II (GII) target nucleic acid sequence of SEQ ID NO: 4 or a complement thereof, wherein the third nucleic acid probe is detectably labeled and comprises 5′d ACGTGGGAGGGCGATCGCAATCT 3′ (SEQ ID NO: 11) or a complement thereof.

### Claim 6 (depends on 5)

The method of claim 5, wherein the first nucleic acid probe is detectably labelled with CFR610 fluorophore, and/or wherein the second nucleic acid probe is detectably labelled with CFR610 fluorophore, and/or wherein the third nucleic acid probe is detectably labelled with FAM fluorophore.

### Claim 7 (depends on 1)

The method of claim 1, further comprising contacting the stool sample with a third primer pair that amplifies a control target nucleic acid of SEQ ID NO: 12 or a complement thereof, and optionally wherein the third primer pair consists of a third forward primer comprising 5′d CTCGTCGACAATGGCGGAA 3′ (SEQ ID NO: 13) and a third reverse primer comprising 5′d TTCAGCGACCCCGTTAGC 3′ (SEQ ID NO: 14).

### Claim 8 (depends on 7)

The method of claim 7, further comprising contacting the stool sample with a fourth nucleic acid probe that specifically hybridizes to a segment of the control target nucleic acid or a complement thereof, wherein the fourth nucleic acid probe is detectably labeled and comprises 5′d GCTTGGGGCGACAGTCACGTCGC 3′ (SEQ ID NO: 15) or a complement thereof, and optionally wherein the fourth nucleic acid probe is detectably labelled with Q670 fluorophore.

### Claim 9 (depends on 1)

The method of claim 1, wherein real-time RT-PCR amplification is performed in a direct amplification disc in concert with an integrated thermal cycler and/or wherein the stool sample comprises unformed stool, formed stool, or a rectal swab stored in liquid Amies media.

### Claim 10

A kit for detecting the presence of at least one pathogenic Norovirus genogroup in a biological sample comprising:
(a) a first primer pair that amplifies a Norovirus genogroup I (GI) target nucleic acid of SEQ ID NO: 2 or a complement thereof; and
(b) a second primer pair that amplifies a Norovirus genogroup II (GII) target nucleic acid of SEQ ID NO: 4 or a complement thereof
wherein the first primer pair consists of a first forward primer comprising 5′d CGYTGKATGCGITTYCATGA 3′ (SEQ ID NO: 5) and a first reverse primer comprising 5′d TCCTTAGACGCCATCATCATTTAC 3′ (SEQ ID NO: 6), and/or wherein the second primer pair consists of a second forward primer comprising 5′d TGTTYAGGTGGATGAGRTTCTCIGA 3′ (SEQ ID NO: 9 and a second reverse primer comprising 5′d TCGACGCCATCTTCATTCACA 3′ (SEQ ID NO: 10).

### Claim 11 (depends on 10)

The kit of claim 10, further comprising a third primer pair that amplifies a control target nucleic acid of SEQ ID NO: 12 or a complement thereof.

### Claim 12 (depends on 11)

The kit of claim 11, wherein the third primer pair consists of a third forward primer comprising 5′d CTCGTCGACAATGGCGGAA 3′ (SEQ ID NO: 13) and a third reverse primer comprising 5′d TTCAGCGACCCCGTTAGC 3′ (SEQ ID NO: 14).

### Claim 13 (depends on 10)

The kit of claim 10, wherein the kit further comprises
a first nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup I (GI) target nucleic acid sequence of SEQ ID NO: 2 or a complement thereof, wherein the first nucleic acid probe is detectably labeled and optionally comprises 5′d TGGACAGGAGAYCGCIATCTCYTGCCCGA 3′ (SEQ ID NO: 7), or a complement thereof, and/or
a second nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup I (GI) target nucleic acid sequence of SEQ ID NO: 2 or a complement thereof, wherein the second nucleic acid probe is detectably labeled and optionally comprises 5′d TGGACAGGAGATCGCAATCTACTGCCTGA 3′(SEQ ID NO: 8), or a complement thereof, and/or
a third nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup II (GII) target nucleic acid sequence of SEQ ID NO: 4 or a complement thereof, wherein the third nucleic acid probe is detectably labeled and
optionally comprises 5′d ACGTGGGAGGGCGATCGCAATCT 3′ (SEQ ID NO: 11) or a complement thereof, and/or
a fourth nucleic acid probe that specifically hybridizes to a segment of the control target nucleic acid of SEQ ID NO: 12 or a complement thereof, wherein the fourth nucleic acid probe is detectably labeled and comprises 5′d GCTTGGGGCGACAGTCACGTCGC 3′ (SEQ ID NO: 15), or a complement thereof.

### Claim 14

A method for selecting a patient suffering from acute gastroenteritis for treatment with a therapeutic agent that inhibits Norovirus genogroup II (GII) comprising:
contacting a stool sample obtained from the patient with:
(i) a first primer pair that amplifies a Norovirus genogroup I (GI) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 2 or a complement thereof; and
(ii) a second primer pair that amplifies a Norovirus genogroup II (GII) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 4 or a complement thereof;
to produce a reaction-sample mixture under conditions where real-time RT-PCR amplification of the Norovirus genogroup I (GI) and Norovirus genogroup II (GII) target nucleic acids, if present in the stool sample, occurs without extracting the target nucleic acids from the stool sample.

### Claim 15 (depends on 3)

The method of claim 3, further comprising:
(a) subjecting the reaction-sample mixture to real-time RT-PCR conditions under which each of the target nucleic acids present in the stool sample is amplified to produce a fluorescent signal;
(b) detecting the fluorescent signal generated by each amplified target nucleic acid produced in step (a); and
(c) selecting the patient for treatment with a therapeutic agent that inhibits Norovirus genogroup II (GII), if a fluorescent signal for the Norovirus genogroup II (GII) target nucleic acid is detected,
wherein the stool sample is not subjected to an extraction or purification step prior to amplification.

### Claim 16 (depends on 14)

The method of claim 14, wherein the therapeutic agent that inhibits Norovirus genogroup II (GII) is one or more agents selected from the group consisting of GII.4/VA387-derived P particle vaccines, GII.4-derived virus-like particles (VLPs) vaccines, VLPs derived from a consensus GII.4 sequence and Norwalk virus with Alhydrogel adjuvant, and VLPs derived from GII.4 Human Norovirus VP1 with rotavirus VP6 antigen.

### Claim 17

A method for selecting a patient suffering from acute gastroenteritis for treatment with a therapeutic agent that inhibits Norovirus genogroup II (GII) and an additional therapeutic agent that inhibits Norovirus genogroup I (GI) comprising:
contacting a stool sample obtained from the patient with:
(i) a first primer pair that amplifies a Norovirus genogroup I (GI) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 2 or a complement thereof; and
(ii) a second primer pair that amplifies a Norovirus genogroup II (GII) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 4 or a complement thereof,
to produce a reaction-sample mixture under conditions where real-time RT-PCR amplification of the Norovirus genogroup I (GI) and Norovirus genogroup II (GII) target nucleic acids, if present in the stool sample, occurs without extracting the target nucleic acids from the stool sample.

### Claim 18 (depends on 17)

The method of claim 17, further comprising:
(a) subjecting the reaction-sample mixture to real-time RT-PCR conditions under which each of the target nucleic acids present in the stool sample is amplified to produce a fluorescent signal;
(b) detecting the fluorescent signal generated by each amplified target nucleic acid produced in step (a); and
(c) selecting the patient for treatment with a therapeutic agent that inhibits Norovirus genogroup II (GII) and an additional therapeutic agent that inhibits Norovirus genogroup I (GI), if (i) a fluorescent signal for the Norovirus genogroup I (GI) target nucleic acid and a fluorescent signal for the Norovirus genogroup II (GII) target nucleic acid are detected,
wherein the stool sample is not subjected to an extraction or purification step prior to amplification.

### Claim 19 (depends on 17)

The method of claim 17, wherein the therapeutic agent that inhibits Norovirus genogroup II (GII) is one or more agents selected from the group consisting of GII.4/VA387-derived P particle vaccines, GII.4-derived virus-like particles (VLPs) vaccines, VLPs derived from a consensus GII.4 sequence and Norwalk virus with Alhydrogel adjuvant, and VLPs derived from GII.4 Human Norovirus VP1 with rotavirus VP6 antigen, and/or wherein the additional therapeutic agent that inhibits Norovirus genogroup I (GI) is one or more agents selected from the group consisting of serum histo-blood group antigen (HBGA) blocking antibodies, ribavirin, favipiravir, 2′-C-methylcytidine, suramin-related compounds, IFNs α, β or γ, dipeptidyl inhibitors of norovirus 3CL protease, Pyridoxal-5′-phosphate-6-(2′-naphthylazo-6′-nitro-4′,8′-disulfonate) tetrasodium salt (PPNDS), naphthalene di-sulfonate (NAF2), non-nucleoside inhibitors, GI.1 plus GII.4 consensus VLP bivalent vaccine, and small molecule deubiquitinase inhibitor.