RNA-guided human genome engineering
AssigneePresident and Fellows of Harvard College
InventorsPrashant G. Mali, George M. Church, Luhan Yang
Life of this patent
Estimating the term…
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims10
A method of modulating expression of a target nucleic acid in a eukaryotic cell comprising
- providing to the cell a guide RNA sequence complementary to the target nucleic acid sequence,
- providing to the cell a Cas9 protein having inactive nuclease domains that interacts with the guide RNA sequence and binds to the target nucleic acid sequence in a site specific manner,
- wherein the Cas9 protein having inactive nuclease domains includes a transcriptional activator or repressor domain attached thereto for modulating target nucleic acid expression in vivo,
- wherein the guide RNA sequence and the Cas9 protein including the transcriptional activator or repressor domain co-localize to the target nucleic acid sequence and wherein the transcriptional activator or repressor domain modulates expression of the target nucleic acid,
- wherein the guide RNA sequence includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence having the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
Dependencies are inferred from the claim text.