Anti-annexin A2 monoclonal antibodies

An antigen-binding protein, or an antigen-binding fragment thereof, comprising:

• (a) (i) a heavy chain variable domain comprising a VHCDR1 having an amino acid sequence encoded by the nucleic acid sequence GCTACTCCATCACCAGTGGTTATAGCTGGCAC (SEQ ID NO:
• 15);
• a VHCDR2 having an amino acid sequence encoded by the nucleic acid sequence ACATACACTACAGTGGTAGCACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO:
• 16), and a VHCDR3 having an amino acid sequence encoded by the nucleic acid sequence GGAGTAACTACGGATTTGACTACT (SEQ ID NO:
• 17);
• and (ii) a light chain variable domain comprising a VLCDR1 having an amino acid sequence encoded by the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAACGATCAAAAGAACTACTTGGCC T (SEQ ID NO:
• 18), a VLCDR2 having an amino acid sequence encoded by the nucleic acid sequence GGGCATCTATTAGGGAATCTG (SEQ ID NO:
• 19), and a VLCDR3 having an amino acid sequence encoded by the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO:
• 20), or
• (b) (i) a heavy chain variable domain comprising a VHCDR1 having an amino acid sequence encoded by the nucleic acid sequence TCTACTCCATCACCAGTGGTTATAGCTGGCACT (SEQ ID NO:
• 25);
• a VHCDR2 having an amino acid sequence encoded by the nucleic acid sequence ACATACACTACAGTGGTAGTACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO:
• 26), and a VHCDR3 having an amino acid sequence encoded by the nucleic acid sequence GGACCGACAATGCTGTGGACTACT (SEQ ID NO:
• 27);
• and (ii) a light chain variable domain comprising a VLCDR1 having an amino acid sequence encoded by the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAAAGAACTACTTGGCC T (SEQ ID NO:
• 28), a VLCDR2 having an amino acid sequence encoded by the nucleic acid sequence GGGCATCCAGTAGGGAATCTG (SEQ ID NO:
• 29), and a VLCDR3 having an amino acid sequence encoded by the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO:
• 20).

A composition comprising a physiologically acceptable carrier and a therapeutically effective amount of an antigen-binding protein, or an antigen-binding fragment thereof comprising:

• (a)(i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GYSITSGYSWH (SEQ ID NO:
• 9);
• a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO:
• 10) and a VHCDR3 having the amino acid sequence GSNYGFDY (SEQ ID NO:
• 11);
• and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSNDQKNYLA (SEQ ID NO:
• 12), a VLCDR2 having the amino acid sequence WASIRES (SEQ ID NO:
• 13), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO:
• 14), or
• (b) (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence VYSITSGYSWH (SEQ ID NO:
• 21);
• a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO:
• 10), and a VHCDR3 having the amino acid sequence GTDNAVDY (SEQ ID NO:
• 22);
• and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSSNQKNYLA (SEQ ID NO:
• 23), a VLCDR2 having the amino acid sequence WASSRES (SEQ ID NO:
• 24), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO:
• 14);
• wherein the antigen-binding protein, or antigen-binding fragment thereof, binds to ANXA2.