US 10,590,416 B2 · RNAi agents for inhibiting expression of alpha-ENaC and methods of use

Abstract

Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an alpha-ENaC (SCNN1A) gene. The alpha-ENaC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an alpha-ENaC gene. Pharmaceutical compositions that include one or more alpha-ENaC RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described alpha-ENaC RNAi agents to epithelial cells, such as pulmonary epithelial cells, in vivo, provides for inhibition of alpha-ENaC gene expression and a reduction in ENaC activity, which can provide a therapeutic benefit to subjects, including human subjects.

Claims52

Dependent claims

An RNAi agent for inhibiting expression of an alpha-ENaC gene, comprising:

an antisense strand comprising the nucleotide sequence (5′→3′) UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3);
and
a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand;
wherein all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides.

1 more element

Dependencies are inferred from the claim text.

Facts

Application

16/028,006Filed 5 Jul 2018 · us provisional application

Priority

6 Jul 2017

Published

US 2019/0010494 A110 Jan 2019

Granted

17 Mar 2020

Term ends

Not estimatedThe source records don’t support an estimate.

Classification13 codes

C12N 15/113
DNA or RNA fragments; Modified forms thereof ; Non-coding nucleic acids having a biological activity: non-coding nucleic acids modulating the…
A61P 5/40
Of the suprarenal hormones: mineralocorticosteroids, e.g. aldosterone; Drugs increasing or potentiating the activity of mineralocorticosteroids
C12N 15/1138
Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming…: against…
C12N 2310/14
Type of nucleic acid: interfering nucleic acids [NA]

Family

Application62/529,132Us provisional application · filed 6 Jul 2017

Application62/631,683Us provisional application · filed 17 Feb 2018

Application62/679,549Us provisional application · filed 1 Jun 2018

US 2019/0010494 A1Pre-grant publication · published 10 Jan 2019

US 10,590,416 B2This patent

From the US filing history. Foreign family members aren’t listed.

RNAi agents for inhibiting expression of alpha-ENaC and methods of use

Life of this patent

RNAi agents for inhibiting expression of alpha-ENaC and methods of use

Life of this patent

Abstract

Claims52