Antisense oligonucleotides for modulating HTRA1 expression
AssigneeHoffmann-La Roche Inc.
InventorsRoberto Iacone, Peter Hagedorn, Susanne Kammler, Soren Ottosen, Sindri Traustason, Heidi Hudlebusch, Lykke Pedersen
Life of this patent
Estimating the term…
Abstract
The present invention relates to antisense oligonucleotides (oligomers) that are complementary to HTRA1, leading to modulation of the expression of HTRA1. Modulation of HTRA1 expression is beneficial for a range of medical disorders, such as macular degeneration, e.g. age-related macular degeneration.
Claims42
An antisense oligonucleotide of 10-30 nucleotides in length, wherein said antisense oligonucleotide targets a human high temperature requirement A 1 (HTRA1) nucleic acid and comprises a contiguous nucleotide region of 10-22 nucleotides which is perfectly complementarity
- (SEQ ID NO 147)
- 5′ CCAACAACCAGGTAAATATTTG 3′
- and wherein the nucleotides are linked by phosphorothioate linkages.
A compound having the formula:
- or a pharmaceutically acceptable salt thereof.
The antisense oligonucleotide of formula:
- CsAsAsAstsastststsascscstsgsGsTsTsG (SEQ ID NO 138, Comp # 138,1), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- TsTstsascscstsgsgststsgstsTsGsG (SEQ ID NO 139, Comp # 139,1), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- CsCsAsAsastsastststsascscstsgsGsTsT (SEQ ID NO 140, Comp # 140,1),wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- CsCsAsasastsastststsascscstsgsgststsGsT (SEQ ID NO 141, Comp # 141,1), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- AsTsAstststsascscstsgsgststsgsTsTsG (SEQ ID NO 142, Comp # 142,1), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- TsAsTststsascscstsgsgstsTsGsTsT (SEQ ID NO 143, Comp # 143,1), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- TsAstststsascscstsgsGstsTsgsTsT (SEQ ID NO 143, Comp # 143,2), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- TsAsTststsascscstsgsgsTsTsgsTsT (SEQ ID NO 143, Comp # 143,3), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- AsTsAsTststsascscstsgsgsTsTsGsT (SEQ ID NO 144, Comp # 144,1), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- AstsAsTsTstsascscstsgsgstsTsGsT (SEQ ID NO 144, Comp # 144,2), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- AstsAsTststsascscstsgsGsTsTsgsTsT (SEQ ID NO 145, Comp # 145,1), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- AsTsAstststsascscstsgsGstsTsgsTsT (SEQ ID NO 145, Comp # 145,2), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
The antisense oligonucleotide of formula:
- AstsAsTststsascscstsgsgstsTsGsTsT (SEQ ID NO 145, Comp # 145,3), wherein a capital letter represents an LNA nucleoside unit, a lower case letter represents a DNA nucleoside unit, s represents a phosphorothioate internucleoside linkage, and all LNA cytosines are 5-methyl cytosine.
Dependencies are inferred from the claim text.