Back to results
US 10,519,198 B2Granted
Selective recovery
AssigneeCalifornia Institute of Technology
InventorsBenjamin E. Deverman, Paul H. Patterson, Viviana Gradinaru
Life of this patent
Estimating the term…
Abstract
Provided herein are methods of selective screening. In addition, various targeting proteins and sequences, as well as methods of their use, are also provided.
Claims9
An AAV polynucleotide comprising a capsid sequence, wherein said capsid sequence (a) encodes an AAV capsid protein, (b) has at least 99% identity to SEQ ID NO:
- 11, and (c) comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO:
- 24) and which encodes at least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID NO:
- 1).
An AAV capsid protein encoded by an AAV polynucleotide comprising a capsid sequence, wherein said capsid sequence (a) encodes said AAV capsid protein, (b) has at least 99% identity to SEQ ID NO:
- 11, and (c) comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO:
- 24) and which encodes at least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID NO:
- 1).
Dependencies are inferred from the claim text.