Materials and methods for modulation of tendon healing
AssigneeThe University Court of the University of Glasgow
InventorsDerek Stewart Gilchrist, Neal Lindsay Millar
Life of this patent
Estimating the term…
Abstract
The invention relates to the use of microRNA 29 and precursors and mimics thereof for the modulation of tendon injury and the biomechanical properties of tendon. In particular, the invention derives from the finding that synthesis of type 1 collagen in tenocytes is less sensitive to miR-29 than is synthesis of type 3 collagen, thus enabling the balance between the collagen subtypes to be modulated in favour of type 1 collagen, mitigating reduction in biomechanical properties during healing.
Claims12
A method for modulating relative collagen compositions in a tissue in need thereof, the method comprising delivering to the tissue a mimic of miR-29b,
- wherein the miR-29b mimic comprises a guide strand and a passenger strand,
- wherein the guide strand comprises the sequence
- (SEQ ID NO:
- 2)
- UAGCACCAUUUGAAAUCAGUGUU (hsa-miR-29b1 and 2);
- (wherein the seed sequence is underlined),
- or which differs from SEQ ID NO:
- 2 at:
- (i) no more than three positions within the seed sequence;
- and
- (ii) no more than five positions outside the seed sequence,
- wherein one of the strands has a 3′ overhang,
- wherein the miR-29b mimic includes at least a mismatch between the strands, and
- wherein at least one residue of the miR-29b mimic is a 2′-O-methyl ribose or 2′-fluoro ribose.
A method for modulating relative collagen compositions in a tissue in a human in need thereof, the method comprising delivering to the tissue a mimic of miR-29b, wherein the miR-29b mimic comprises a guide strand and a passenger strand,
- wherein the guide strand comprises the sequence
- (SEQ ID NO:
- 2)
- UAGCACCAUUUGAAAUCAGUGUU
- (wherein the seed sequence is underlined),
- wherein one of the strands has a 3′ overhang,
- wherein the miR-29b mimic includes at least a mismatch between the strands, and
- wherein at least one residue of the miR-29b mimic is a 2′-O-methyl ribose or 2′-fluoro ribose.
Dependencies are inferred from the claim text.