# US 10,369,167 B2 · Continuously expressed therapeutic RNAs for targeted protein binding and methods for their use

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 10,369,167 B2
- Document ID: US10369167B2
- Status: Granted
- Kind: B2
- Application number: 15/800,836
- Filed: 2017-11-01
- Published: 2018-05-10
- Granted: 2019-08-06
- Earliest claimed: 2016-11-01
- Assignees: City of Hope
- Applicants: City of Hope
- Inventors: Ka Ming Pang; John J. Rossi
- Web page: https://patentgrep.com/patent/US10369167B2

## CPC

- A61K 31/7105: Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
- A61K 9/0019: {Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner (non-active ingredients are additionally classified in A61K47/00)}
- A61P 31/18: for HIV
- C12N 15/1132: {against retroviridae, e.g. HIV}
- C12N 15/115: Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith {; Nucleic acids binding to non-nucleic acids, e.g. aptamers}
- C12N 2310/14: interfering nucleic acids [NA]
- C12N 2310/141: MicroRNAs, miRNAs
- C12N 2310/16: Aptamers
- C12N 2310/3519: Fusion with another nucleic acid
- C12N 2310/531: Stem-loop; Hairpin
- C12N 2320/31: Combination therapy
- C12N 2320/32: Special delivery means, e.g. tissue-specific
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)

## Abstract

An RNA composition comprising an RNA aptamer and an shRNA molecule and/or an miRNA molecule are provided. The RNA composition may include an aptamer component that binds an enzymatic protein within a target cell and an shRNA and/or an miRNA component that facilitates trafficking of the aptamer within the target cell, such as, trafficking from the nucleus into the cytoplasm. The RNA aptamer and the shRNA and/or the miRNA component of the composition can be a fusion or independent molecules.

## Claims

### Claim 1

An RNA composition comprising:
an RNA aptamer molecule comprising a nucleotide sequence of CGTATGGGTGAGCCCGTTAAGATTGCGCGT (SEQ ID NO:1) that targets an enzymatic protein; and
an shRNA molecule that transports the RNA aptamer to a desired location, wherein the RNA aptamer molecule and the shRNA molecule are fused together.

### Claim 2 (depends on 1)

The RNA composition claim 1, wherein the RNA aptamer binds to and inhibits activity of the enzymatic protein.

### Claim 3 (depends on 2)

The RNA composition of claim 2, wherein the enzymatic protein is integrase.

### Claim 4 (depends on 3)

The RNA composition claim 3, wherein the integrase an HIV integrase.

### Claim 5 (depends on 2)

The RNA composition of claim 2, wherein the enzymatic protein is a reverse transcriptase.

### Claim 6 (depends on 1)

The RNA composition of claim 1, wherein the shRNA is an anti-HIV shRNA.

### Claim 7 (depends on 6)

The RNA composition of claim 6, wherein the anti-HIV shRNA is an anti-HIV Tat-Rev shRNA.

### Claim 8 (depends on 1)

The RNA composition of claim 1, wherein the RNA aptamer is part of a pharmaceutical composition which further comprises a pharmaceutical carrier.

### Claim 9

A method of delivering a therapeutic agent to an HIV-infected cell comprising:
contacting the HIV-infected cell with an RNA composition, wherein the RNA composition comprises an RNA aptamer component fused to a therapeutic agent component comprising an shRNA molecule; and
wherein the RNA aptamer comprises a nucleotide sequence of CGTATGGGTGAGCCCGTTAAGATTGCGCGT (SEQ ID NO:1) and binds an enzymatic protein expressed by non-host DNA or non-host RNA, resulting in inhibition of activity of the enzymatic protein.

### Claim 10 (depends on 9)

The method of claim 9, wherein the shRNA molecule is an anti-HIV shRNA.

### Claim 11 (depends on 9)

The method of claim 9, wherein the enzymatic protein is an HIV integrase.

### Claim 12 (depends on 9)

The method of claim 9, wherein binding the enzymatic protein with the RNA aptamer is accomplished by administering the RNA composition to a subject intravenously (i.v).

### Claim 13

A pharmaceutical composition:
comprising an RNA composition, wherein the RNA composition comprises an RNA aptamer having a nucleotide sequence of CGTATGGGTGAGCCCGTTAAGATTGCGCGT (SEQ ID NO:1) that specifically binds an enzymatic protein fused to an shRNA molecule, and a pharmaceutically acceptable carrier.