Back to results
US 10,329,601 B2Granted
Nicking and extension amplification reaction (NEAR) of Streptococcus species
AssigneeIonian Technologies, Inc.
InventorsDaiwei Shen, Richard Roth, Honghua Zhang
Life of this patent
Estimating the term…
Abstract
This invention relates to compositions, methods and kits for detecting the presence or absence of a bacterial species in a biological sample using isothermal nucleic acid amplification.
Claims42
A composition comprising
- i) a forward template comprising a nucleic acid sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of the Streptococcus pyogenes (S. pyogenes) cell envelope proteinase A (cepA) gene antisense strand;
- a nicking enzyme binding site and a nicking site upstream of said recognition region;
- and a stabilizing region upstream of said nicking site, the forward template comprising a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 1 (AGACTCCATATGGAGTCTAGCCAAACAGGAACA) or a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 8 (AGACTCCACACGGAGTCTAGCCAAACAGGAACA);
- and
- ii) a reverse template comprises a nucleotide sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of the S. pyogenes cepA gene sense strand;
- a nicking enzyme binding site and a nicking site upstream of said recognition region;
- and a stabilizing region upstream of said nicking site, the reverse template comprising a nucleotide sequence having at least 80, 85 or 95% identity to SEQ ID NO:
- 2 (CGACTCCATATGGAGTCGAAAGCAATCTGAGGA) or a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 9 (GGACTCCACACGGAGTCCGCCAGCAATCUGAGG).
8 more elements
A method for the detection of the presence or absence of S. pyogenes in a biological sample, wherein the method comprises:
- contacting the biological sample with components comprising
- i) a forward template comprising a nucleic acid sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of the Streptococcus pyogenes cell envelope proteinase A (cepA) gene antisense strand;
- a nicking enzyme binding site and a nicking site upstream of said recognition region;
- and a stabilizing region upstream of said nicking site, wherein the forward template comprises a nucleotide sequence having at least at least 80, 85, or 95% identity to SEQ ID NO:
- 1 (AGACTCCATATGGAGTCTAGCCAAACAGGAACA) or a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 8 (AGACTCCACACGGAGTCTAGCCAAACAGGAACA);
- ii) a reverse template comprises a nucleotide sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of the Streptococcus pyogenes cepA gene sense strand;
- a nicking enzyme binding site and a nicking site upstream of said recognition region;
- and a stabilizing region upstream of said nicking site, wherein the reverse template comprises a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 2 (CGACTCCATATGGAGTCGAAAGCAATCTGAGGA) or a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 9 (GGACTCCACACGGAGTCCGCCAGCAATCUGAGG), and
- (iii) a first nicking enzyme that is capable of nicking at the nicking site of said forward template and does not nick within said target sequence,
- (iv) a second nicking enzyme that is capable of nicking at the nicking site of said reverse template and does not nick within said target sequence, and
- (v) a DNA polymerase;
- amplifying the target nucleic acid sequence in a nucleic amplification reaction to provide an amplification product;
- and detecting the presence or absence of the amplification product.
13 more elements
A kit comprising:
- a forward template oligonucleotide comprising a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 1 (AGACTCCATATGGAGTCTAGCCAAACAGGAACA) and/or
- a forward template oligonucleotide comprising a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 8 (AGACTCCACACGGAGTCTAGCCAAACAGGAACA);
- and
- a reverse template oligonucleotide comprising a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 2 (CGACTCCATATGGAGTCGAAAGCAATCTGAGGA) and/or a reverse template oligonucleotide comprising a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO:
- 9 (GGACTCCACACGGAGTCCGCCAGCAATCUGAGG);
- and a polymerase.
6 more elements
Dependencies are inferred from the claim text.