Antagonistic PD-1 aptamer and its applications in cancer therapy related applications
AssigneesAcademia Sinica, National Taiwan University
InventorsPan-Chyr Yang, Yi-Chung Chang, Wei-Yun Lai
Life of this patent
Estimating the term…
Abstract
Aptamers that bind to and antagonize programmed cell death protein 1 (PD-1). Also provided herein are pharmaceutical compositions comprising such anti-PD-1 aptamers and methods for using the same for promoting T cell proliferation, treating cancer or infectious diseases, such as human immunodeficiency virus (HIV) infection.
Claims31
A nucleic acid aptamer capable of binding programmed cell death protein 1 (PD-1), wherein the aptamer:
- comprises the nucleic acid sequence of
- (SEQ ID NO:
- 10)
- TCCCTACGGCGCTAACCTTCCATCTCCCATGCTTAGTCAAACATACGCC
- ACCGTGCTACAAC.
An anti-PD-1 aptamer dimer, comprising a first anti-PD-1 aptamer, a second anti-PD-1 aptamer, and a polymer moiety that links the first anti-PD-1 aptamer and the second anti-PD-1 aptamer, wherein both the first anti-PD-1 aptamer and the second anti-PD-1 aptamer comprise the nucleic acid sequence of SEQ ID NO:10.
Dependencies are inferred from the claim text.