Editing profiling of PDE8A pre-mRNA: use as specific biomarker of ADARs activities in human tissues to diagnose and to predict and assess therapeutic efficacy and/or efficiency or potential drug side effects

A method, comprising:

• a) providing a biological subject sample comprising Peripheral Blood Mononuclear Cells (PBMC), said PBMC expressing the editing enzymes ADAR1a, ADAR1b and ADAR2, and the phosphodiesterase subtype 8A (PDE8A);
• b) preparing a cellular RNA extract from the subject sample;
• c) determining the editing profile of the PDE8A pre-mRNA in said cellular RNA extract;
• and
• d) administering a treatment for a pathology selected from the group consisting of psychiatric disorders, mental disorders, schizophrenia, depression, Bipolar disease, suicide or abnormal feeding behaviour, Mild Cognitive Impairement (MCI), Epilepsia, Alzheimer and Chronical pain syndromes to the subject.

An in vitro method for the diagnosis or for identifying whether a patient presents a pathology or is at risk to develop a pathology selected from the group consisting of psychiatric disorders, mental disorders, schizophrenia, depression, Bipolar disease, suicide or abnormal feeding behaviour, Mild Cognitive Impairement (MCI), Epilepsia, Alzheimer and Chronical pain syndromes, comprising:

• a) providing a biological subject sample comprising Peripheral Blood Mononuclear Cells (PBMC), said PBMC expressing the editing enzymes ADAR1a, ADAR1b and ADAR2, and the phosphodiesterase subtype 8A (PDE8A);
• b) preparing a cellular RNA extract from the subject sample;
• c) determining the editing profile of the PDE8A pre-mRNA in said cellular RNA extract, wherein determining the editing profile of the PDE8A pre-mRNA comprises detecting the ned (non edited isoform) and B isoforms;
• and
• d) identifying whether said patient presents or is at risk to develop such a pathology by comparing the editing profile of the PDE8A pre-mRNA obtained in step c) with control editing profile of the PDE8A pre-mRNA obtained for normal patients and/or for patients exhibiting pathologies related to an alteration of the mechanism of this mRNA editing,
• wherein the editing profile of the PDE8A pre-mRNA is determined by a process comprising performing a reverse transcription reaction on the cellular RNA extract and performing a nested type PCR comprising two rounds of PCR on the product of the reverse transcription, and
• wherein:
• a) the first round of PCR is carried out by the following sets of primers:
• Forward:
• (SEQ ID NO. 13)
• PDE8A-1FWD GCTGAAGCCTTCCTTCTAAGG,
• Reverse:
• (SEQ ID NO. 12)
• PDE8A-1REV GGACCTAGAGTTGACCCAGG,
• and wherein
• b) the second round of PCR is carried out by the following set of primers:
• Forward:
• (SEQ ID NO. 10)
• PDE8A-2Fwd FAM CTAGGGAACCCTGTTTAGTCC,
• Reverse:
• (SEQ ID NO. 11)
• PDE8A-2Rev VIC CAATGGGCACCAAAAAAGGG.