# US 10,307,490 B2 · Lipid nanoparticle compositions for antisense oligonucleotides delivery

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 10,307,490 B2
- Document ID: US10307490B2
- Status: Granted
- Kind: B2
- Application number: 13/900,969
- Filed: 2013-05-23
- Published: 2013-11-28
- Granted: 2019-06-04
- Earliest claimed: 2012-05-23
- Assignees: The Ohio State University
- Applicants: The Ohio State University
- Inventors: Robert J. Lee; Young Bok Lee; Deog Joong Kim; Chang Ho Ahn
- Web page: https://patentgrep.com/patent/US10307490B2

## CPC

- A61K 31/7088: Compounds having three or more nucleosides or nucleotides
- A61K 9/127: Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
- A61K 9/1271: Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers (liposomes as conjugates {A61K47/6911})
- A61K 9/1272: comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers (lipids as modifying agents {A61K47/543})
- A61K 31/713: Double-stranded nucleic acids or oligonucleotides
- A61K 38/08: Peptides having 5 to 11 amino acids {(A61K38/043 - A61K38/046 take precedence)}
- A61K 38/10: Peptides having 12 to 20 amino acids {(A61K38/043 - A61K38/046 take precedence)}
- A61K 38/482: {Serine endopeptidases (3.4.21)}
- A61K 45/06: Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
- A61K 47/543: {Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine}
- A61K 47/544: {Phospholipids}
- A61K 47/549: {Sugars, nucleosides, nucleotides or nucleic acids}
- A61K 47/59: obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
- A61K 47/62: the modifying agent being a protein, peptide or polyamino acid
- A61K 47/643: {Albumins, e.g. HSA, BSA, ovalbumin or a Keyhole Limpet Hemocyanin [KHL]}
- A61K 47/6907: {the form being a microemulsion, nanoemulsion or micelle}
- A61K 47/6911: {the form being a liposome}
- A61P 35/00: Antineoplastic agents
- C07K 16/00: Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- C12N 15/1135: {against oncogenes or tumor suppressor genes}
- C12N 15/1137: {against enzymes (viral enzymes C12N15/1131; receptors C12N15/1138)}
- A61K 48/00: Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- C12N 2310/11: Antisense
- C12N 2310/14: interfering nucleic acids [NA]
- C12Y 304/21064: Peptidase K (3.4.21.64)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C07K: PEPTIDES (peptides in foodstuffs A23; obtaining protein compositions for foodstuffs, working-up proteins for foodstuffs A23J; preparations for medicinal purposes A61K; peptides containing beta-lactam rings C07D; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, C07D; ergot alkaloids of the cyclic peptide type C07D519/02; macromolecular compounds having statistically distributed amino acid units in their molecules, i.e. when the preparation does not provide for a specific; but for a random sequence of the amino acid units, homopolyamides and block copolyamides derived from amino acids C08G69/00; macromolecular products derived from proteins C08H1/00; preparation of glue or gelatine C09H; single cell proteins, enzymes C12N; genetic engineering processes for obtaining peptides C12N15/00; compositions for measuring or testing processes involving enzymes C12Q; investigation or analysis of biological material G01N33/00)
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- C12Y: ENZYMES

## Abstract

Described is a lipid nanoparticle composition that includes a macromolecule conjugated to a polymer and a targeting agent. The composition can include a therapeutic agent. The therapeutic agent can be an antisense oligonucleotide (ASO). Exemplary ASOs are targeted to a portion of a nucleic acid encoding Akt-1, and which modulates the expression of Akt-1; or targeted to a portion of a nucleic acid encoding HIF-1, and which modulates the expression of HIF-1. Also described is a lipid nanoparticle composition that includes a macromolecule conjugated to a polymer and a therapeutic agent that is an ASO such as an ASO targeted to a portion of a nucleic acid encoding Akt-1, and which modulates the expression of Akt-1 or an ASO targeted to a portion of a nucleic acid encoding HIF-1, and which modulates the expression of HIF-1. Pharmaceutical formulations, methods of making the lipid nanoparticles, and methods of using the lipid nanoparticles, for example for treating cancers, are also disclosed.

## Claims

### Claim 1

A lipid nanoparticle composition comprising:
a cationic liposome;
a targeting agent; and
a net positively-charged core comprising an albumin-polycation conjugate,
wherein the cationic liposome encapsulates the net positively-charged core to form a lipid-coated albumin nanoparticle (LCAN).

### Claim 2 (depends on 1)

The lipid nanoparticle composition of claim 1, the net positively-charged core further comprising a therapeutic agent selected from the group consisting of nucleic acids, proteins, polysaccharides, lipids, radioactive substances, prodrugs, and combinations thereof.

### Claim 3 (depends on 2)

The lipid nanoparticle composition of claim 2, wherein the therapeutic agent comprises an antisense oligonucleotide (ASO) selected from the group consisting of
an ASO targeted to a portion of a nucleic acid encoding Akt-1, and which modulates the expression of Akt-1; and
an ASO targeted to a portion of a nucleic acid encoding HIF-1, and which modulates the expression of HIF-1.

### Claim 4 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the albumin is human serum albumin (HSA).

### Claim 5 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the albumin-polycation conjugate comprises pentaethylenehexamine (PEHA) or tetraethylenepentamine.

### Claim 6 (depends on 3)

The lipid nanoparticle composition of claim 3, wherein the antisense oligonucleotide is a compound having a sequence comprising 5′ gctgcatgatctccttggcg 3′ (Seq. Id. No.: 1), targeted to a nucleic acid molecule encoding human Akt-1, and which modulates the expression of Akt-1.

### Claim 7 (depends on 3)

The lipid nanoparticle composition of claim 3, wherein the antisense oligonucleotide is a compound having a sequence comprising 5′aatgagccaccagtgtccaa 3′ (Seq. Id. No.: 2), targeted to a nucleic acid molecule encoding human HIF-1, and which modulates the expression of HIF-1.

### Claim 8 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the targeting agent comprises a moiety selected from RGD peptides, galactose-containing moieties, transferrin, folate, low density lipoprotein, epidermal growth factors, and antibodies.

### Claim 9 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the targeting agent comprises cRGDfC or folate.

### Claim 10 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the targeting agent comprises a conjugate selected from the group consisting of folate-PEG-CHEMS (folate-polyethylene glycol-cholesteryl hemisuccinate), folate-PEG-DSPE (folate-polyethylene glycol-distearoyl phosphatidylethanolamine), and cRGDfC-PEG-DSPE (cyclo(RGDfC)-polyethylene glycol-distearoyl phosphatidylethanolamine).

### Claim 11

A pharmaceutical composition comprising:
a lipid nanoparticle composition comprising
a cationic liposome;
a targeting agent; and
a net positively-charged core comprising an albumin-polycation conjugate and a therapeutic agent, wherein the cationic liposome encapsulates the net positively-charged core to form a lipid-coated albumin nanoparticle (LCAN); and
a pharmaceutically acceptable excipient.

### Claim 12 (depends on 11)

The pharmaceutical composition of claim 11, wherein the therapeutic agent is an antisense oligonucleotide (ASO) selected from the group consisting of an ASO targeted to a portion of a nucleic acid encoding Akt-1, and which modulates the expression of Akt-1; and an ASO targeted to a portion of a nucleic acid encoding HIF-1, and which modulates the expression of HIF-1.

### Claim 13

A method of making a lipid-coated albumin nanoparticle (LCAN), the method comprising
synthesizing a HSA-PEHA conjugate;
preparing a mixture of lipids comprising a cationic lipid and a targeting agent;
adding the mixture of lipids to the HSA-PEHA conjugate, wherein the mixture of lipids form a cationic liposome that encapsulates the HSA-PEHA conjugate; and
adding a therapeutic agent to the mixture of lipids and the HSA-PEHA conjugate to obtain an LCAN precursor.

### Claim 14 (depends on 13)

The method of claim 13, wherein the therapeutic agent comprises an antisense oligonucleotide (ASO) selected from the group consisting of an ASO targeted to a portion of a nucleic acid encoding Akt-1, and which modulates the expression of Akt-1; and an ASO targeted to a portion of a nucleic acid encoding HIF-1, and which modulates the expression of HIF-1.

### Claim 15 (depends on 13)

The method of claim 13, further comprising adding the targeting agent to the cationic liposome and the HSA-PEHA conjugate.

### Claim 16 (depends on 15)

The method of claim 15, wherein the lipids comprising a targeting agent selected from the group consisting of folate-PEG-CHEMS (folate-polyethylene glycol-cholesteryl hemisuccinate), folate-PEG-DSPE (folate-polyethylene glycol-distearoyl phosphatidylethanolamine), and cRGDfC-PEG-DSPE (cyclo(RGDfC)-polyethylene glycol-distearoyl phosphatidylethanolamine).

### Claim 17 (depends on 11)

A method of treating a cancer or infectious disease, the method comprising administering an effective amount of a pharmaceutical composition of claim 11 to a patient in need thereof.

### Claim 18 (depends on 17)

The method of claim 17, wherein the cancer is selected from the group consisting of brain cancer, bladder cancer, lung cancer, breast cancer, melanoma, skin cancer, epidermal carcinoma, colon and rectal cancer, non-Hodgkin lymphoma, endometrial cancer, pancreatic cancer, kidney cancer, prostate cancer, leukemia thyroid cancer, head and neck cancer, ovarian cancer, hepatocellular cancer, cervical cancer, sarcomas, gastric cancers, multiple myeloma, lymphomas, gastrointestinal cancer, and uterine cancer.

### Claim 19 (depends on 5)

The lipid nanoparticle composition of claim 5, wherein the albumin-polycation conjugate is a HSA-PEHA conjugate.

### Claim 20 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the albumin-polycation conjugate comprises polyethylenimine (PEI).

### Claim 21 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the targeting agent is coated on the surface of the cationic liposome.

### Claim 22 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the polycation comprises PEHA, wherein the mole ratio of the PEHA to the albumin is between 10 to 1 and 12 to 1.

### Claim 23 (depends on 22)

The lipid nanoparticle composition of claim 22, wherein the mole ratio of the PEHA to the albumin is about 11 to 1.

### Claim 24 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the cationic liposome comprises a cationic lipid selected from the group consisting of: 3β-[N(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-Chol); 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP); 1,2-dioleoyl-3-dimethylammonium-propane (DODAP); dimethyldioctadecylammonium bromide salt (DDAB); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine chloride (DL-EPC); N-[1-(2,3-dioleyloyx) propyl]-N—N—N-trimethyl ammonium chloride (DOTMA); N-[1-(2,3-dioleyloyx) propyl]-N—N—N-dimethyl ammonium chloride (DODMA); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine chloride (DOEPC); N,N-dioctadecyl-N,N-dimethylammonium chloride (DODAC); N-(1-(2,3-dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoracetate (DOSPA); 1,2-dimyristyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE); dioctadecylamidoglycylspermine (DOGS); neutral lipids conjugated to cationic modifying groups; and combinations thereof.

### Claim 25 (depends on 1)

The lipid nanoparticle composition of claim 1, further comprising a stabilizing component.

### Claim 26 (depends on 25)

The lipid nanoparticle composition of claim 25, wherein the stabilizing component is selected from D-alpha tocopheryl polyethylene glycol 1000 succinate (TPGS) or mPEG-DSPE.

### Claim 27 (depends on 13)

The method of claim 13, wherein the mixture of lipids comprises DOTAP, soyPC, and TPGS, and wherein the targeting agent comprises cRGDfC-PEG-DSPE.

### Claim 28 (depends on 27)

The method of claim 27, wherein the molar ratio of DOTAP:soyPC:TPGS:cRGD-PEG-DSPE is about 25:70:4:1.

### Claim 29 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the lipid nanoparticle has a particle size under about 300 nm.

### Claim 30 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the lipid nanoparticle has a particle size under about 150 nm.

### Claim 31 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the albumin-polycation conjugate comprises spermine or spermidine.

### Claim 32 (depends on 1)

The lipid nanoparticle composition of claim 1, wherein the polycation is selected from the group consists of polyethylenimine (PEI); pentaethylenehexamine (PEHA); tetraethylenepentamine; spermine; spermidine; poly(L-lysine); poly(amido amine) (PAMAM) dendrimers; polypropyleneimine dendrimers; poly(2-dimethylamino ethyl)-methacrylate (pDMAEMA); chitosan; tris(2-aminoethyl)amine and its methylated derivatives; and combinations thereof.