# US 10,206,955 B2 · Compositions of ascorbic acid and bone morphogenetic protein 4 (BMP-4) for cell growth and uses related thereo > Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt - Number: US 10,206,955 B2 - Document ID: US10206955B2 - Status: Granted - Kind: B2 - Application number: 14/933,052 - Filed: 2015-11-05 - Published: 2016-06-16 - Granted: 2019-02-19 - Earliest claimed: 2014-11-05 - Assignees: Emory University - Applicants: Emory University - Inventors: Young-Sup Yoon; Jaeyeaon Cho - Web page: https://patentgrep.com/patent/US10206955B2 ## CPC - A61K 35/33: Fibroblasts - A61K 31/375: Ascorbic acid, i.e. vitamin C; Salts thereof - A61K 38/1875: {Bone morphogenic factor; Osteogenins; Osteogenic factor; Bone-inducing factor} - C12N 5/0657: {Cardiomyocytes; Heart cells} - C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} - C12N 2310/141: MicroRNAs, miRNAs - C12N 2320/31: Combination therapy - C12N 2500/38: Vitamins - C12N 2501/155: Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor - C12N 2501/65: MicroRNA - C12N 2506/1307: from adult fibroblasts - A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D) - C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00) ## Abstract This disclosure relates to compositions comprising ascorbic acid and bone morphogenetic protein 4 (BMP-4) for growing cells and making tissues. In certain embodiments, this disclosure relates to methods of creating cardio-mimetic tissues (CMTs) by culturing the cells in the presence of ascorbic acid and bone morphogenetic protein 4 and optionally inserting into cells a muscle specific microRNA or related nucleobase polymer and under conditions such that a cardio-mimetic tissue is formed that is capable of spontaneously contracting. ## Claims ### Claim 1 A method of making cardio-mimetic tissue by mixing fibroblast cells with ascorbic acid and bone morphogenetic protein 4 and inserting into the fibroblast cells a nucleobase polymer with a nucleotide sequence consisting of or comprising a sequence selected from AUAAGACGAACAAAAGGUUUGU (SEQ ID NO: 1), or variant with 65% or greater identity thereto, and under conditions such that a tissue is formed that is capable of spontaneously contracting. ### Claim 2 (depends on 1) The method of claim 1, wherein the cells are human dermal fibroblasts. ### Claim 3 (depends on 1) The method of claim 1, wherein inserting the nucleobase polymer is done by mixing the nucleobase polymer in the presence a cationic lipid and exposing the mixture to a fibroblast cell or by incorporating the nucleotide sequence in a viral nucleic acid or particle, plasmid, or other vector. ### Claim 4 (depends on 1) The method of claim 1, wherein the cardio-mimetic tissue comprises cells that have an increased expression of mRNA Myh6 when compared to cells mixed with ascorbic acid and bone morphogenetic protein 4 in the absence of the nucleobase polymer. ### Claim 5 (depends on 1) The method of claim 1, wherein the cardio-mimetic tissue comprises cells have increased expression of TNNT2 when compared to cells mixed with ascorbic acid and bone morphogenetic protein 4 in the absence of the nucleobase polymer. ### Claim 6 (depends on 1) The method of claim 1, wherein the variant of SEQ ID NO: 1 has one, two, three, four, five, six, or seven nucleotide substitutions, deletions, or combinations thereof. ### Claim 7 (depends on 1) The method of claim 1, wherein the variant of SEQ ID NO: 1 comprises the sequence UAAGACXXXCA(X)nAXGCUU (SEQ ID NO: 2) wherein n is 2 or 3, U is individually and independently uracil or thymine, and X is individually at each occurrence any nucleotide. ### Claim 8 A method of treating heart disease comprising, isolating fibroblast cells from a subject diagnosed with heart disease thereby providing isolated fibroblast cells; making cardio-mimetic tissue capable of spontaneously contracting by the process of inserting or expressing inside the isolated fibroblast cells a nucleobase polymer comprising a nucleotide sequence consisting of or comprising AUAAGACGAACAAAAGGUUUGU (SEQ ID NO: 1), or variant with 65% or greater identity thereto, and then contacting the isolated fibroblast cells with ascorbic acid and bone morphogenetic protein 4 under conditions such that a tissue capable of spontaneously contracting is formed thereby providing a cardiomimetic tissue; and implanting the cardio-mimetic tissue effectively on or in the heart of the subject. ### Claim 9 (depends on 8) The method of claim 8, wherein the cells are fibroblasts or human dermal fibroblasts. ### Claim 10 (depends on 8) The method of claim 8, wherein inserting the nucleobase polymer is done by mixing the nucleobase polymer in the presence a cationic lipid and exposing the mixture to a fibroblast cell or by incorporating the nucleotide sequence in a viral nucleic acid or particle, plasmid, or other vector. ### Claim 11 A method of treating heart disease comprising administering an effective amount of ascorbic acid or prodrug thereof and bone morphogenetic protein 4 in combination with an expression vector encoding a nucleobase polymer comprising sequence AUAAGACGAACAAAAGGUUUGU SEQ ID NO: 1 or variant with 65% or greater identity thereto, to a subject in need thereof, wherein administration is by injection into a peritoneal cavity or heart of the subject. ### Claim 12 (depends on 11) The method of claim 11, wherein the subject is a human. ### Claim 13 (depends on 11) The method of claim 11, wherein bone morphogenetic protein 4 is a human isoform. ### Claim 14 (depends on 11) The method of claim 11, wherein the subject is diagnosed with a myocardial infarction.